Precession – work in the pipeline

Pyramid music

It is common for composers to consider their work through a number of dimensions or axes; examples of which can be found in fugue technique, Whishart’s lattice model (Wishart, 2002) or more extremely, embodied throughout the methodology of 12 tone serialism (Schoenberg and Stein, 1950).

This planar thinking lends itself to the invention of various compositional techniques, on a simplistic level running variables in in retrograde fashion through to the nested recursion of the Art of Fugue (Bach, 1750) and Markov Chain compositional techniques (Roads, 2000). This is often linear, looking at a set of pitches or rhythms; interrogating and manipulating a stream of data points. From there it is only a small step to link extra information to this data. For instance, at a given time a certain note could be played at a specified volume by a given instrument (Boulez, Cage and Nattiez, 1999). Thus, in computing terms we arrive at a two-dimensional array of data, something potentially very close to a square if you were to tabulate it.

With the addition of other data and relationships comes the opportunity for higher dimensions within this array, popping an extra axis into a cube, followed by a tesseract, up until such points as it would be difficult to perceive within an audible work.

What if, rather than dealing with data points the composer was able to manipulate the dimensional space of the larger work?

Precession is an exploration of these ideas. It draws on the Pitch Volume Timbre space defined by Wishart but folds in one side of the ‘cube’ to form a pyramid space. Working from the assumption that pitch is mapped to x volume to y and timbre to z notes can be placed anywhere within the body of the pyramid. This simple translation brings a deal of creative perturbation to the system, as when any datum is near the apex of the pyramid (z axis) its potential placement within the two remaining axes (x,y) across the square base are several limited.

Where this becomes especially interesting is being able to roll the pyramid like a die within compositional space. If the view point remains fixed with x for pitch etc. any movement of the pyramid re-voices the notes therein, potentially in strikingly different ways. Thus, phrases are cast and re-cast within the rolling die of the shape causing processionary transformations of the material.

Instrument design realised in Supercollider

Visual components and data transformation in Processing

Composition and array transformations Excel

System communication OSC

Edward Wright 3/12/19

Bibliography:
Bach, J.S. (2013). The Art of the Fugue & A Musical Offering. Composed c. 1740-50. Newburyport: Dover Publications.
Boulez, P., Cage, J. and Nattiez, J. (1999). The Boulez-Cage correspondence. Cambridge [England]: Cambridge University Press.
Roads, C. (2000). The computer music tutorial. Estados Unidos: The MIT Press.
Schoenberg, A. and Stein, L. (1985). Style and idea. First published 1950. Berkeley: University of California Press.
Wishart, T. (2002). On sonic art. London: Routledge.

Magnificat and Nunc Dimits on Bateriophage phiX174

Today I’ve been working on Magnificat and Nunc Dimits based around the base sequence of the chromosome of bateriophage phiX174 (the first complete mapped genome). On first inspection the code appears rather unpromising.

gagttttatc gcttccatga cgcagaagtt aacactttcg gatatttctg atgagtcgaa…

However the appearance is quite striking.

PhiX174

I’ve re-mapped the sequence to span an octave and imply rhythmic duration, and, oddly with a little bit of tweaking the system it comes out with some unexpectedly beautiful results. The table can be read like any ordinary table. Along the top is the genome ‘letter’ and down the side is how many times it comes in succession eg. aaaaaa would relate to A x 6.

A C G T
1 D A# G D#
2 C B E F
3 A# C C# G
4 G# D A G#
5 F# F A
6 E B
7 C#

According to the table this would result in the note E being sounded. Duration is also mapped by the number of repetitions although a lot more simply, the above Ax6 example would mean that note would last six quavers Tx3 for the quavers and so on. This gives us the original opening of the string:

gagttttatcgcttccatgacgcagaagttaa…

The string is the re-transcribed to show individual ‘events’:

g a g tttt a t c g c tt cc a t g a c g c a g aa g tt aa…

the letter and repetition data is then mapped and transformed as per the grid above giving:

G1 D1 G1 G#4 D1 D#1 A#1 G1 A#1 F2 B2 D1 D#1 G1 D1 A#1 G1 A#1 D1 G1 C2 G1 F2 C2…

This can be then translated into standard notation by simply taking the letter and # to indicate pitch and the number to signify the duration in units of a quaver.

Screen Shot 2013-06-25 at 12.23.01

The notation shows the resulting opening bars. The resulting monophonic line will form the basis of the organ part, tempo dynamics, rests and bar lengths can then be composed around this as the choral lines and text are worked into this sub-structure.

Currently this has been realised relatively simply. I have pasted the genome data into Word and converted it with a find and replace function to give the G1 D1 G1 G#4 D1 D#1 A#1 G1 A#1 F2 B2 D1 D#1 G1 D1 A#1 G1 A#1 D1 G1 C2 G1 F2 C2… string. I then put together a quick program/patch in Max MSP to convert the raw text of the word file into MIDI data and hence to audible pitches.

Screen Shot 2013-06-25 at 12.33.12

To give…

This audio is just the first few minutes of it, hopefully soon I’ll also work out ways of working in other dimensions to extract chords, dynamics and orchestrations out of it too. I have also been rolling out Markov chain stuff to provide a form of mutation to further work the data, but more of that anon.

Philosophically and ideologically I’m quite excited by the idea of combining the word setting and the DNA form. There feels as if there is something a bit subversive and yet also praising about the idea, a tug of war between evolutionary chemistry and the work of divine precision and creation. I can’t quite put my finger on it but working the piece out feels like it may be one amazing ride!