Max MSP Basics

Here is some stuff I put together a while back. It may be useful for some people 🙂
Ed

ground loop

Contents (click to jump to section):

What is Max/MSP?
Working with audio
Numbers, messages and lists
Programme flow and control
Making patches simpler
Playing audio samples
Simple MIDI control
Enveloping and cross-fading
Designing the user interface
Soundfile playback and timing.
Refining soundfile playback control and timing.
More elegant approaches to additive synthesis.
A better way to create polyphony: poly~
Breaking out; physical I/O and Arduino.
Working with acoustic instruments
Audio processing
Further audio manipulation
Jitter
Jitter II
Gen~
OSC
Javascript in Max
Algorithmic composition

What is Max/MSP?

Max/MSP (often just called ‘Max’) is a ‘multimedia programming environment’ which will allow you to create pretty much any kind of music or audio software you can think of. It can also handle video using a built-in extension called ‘Jitter’.

To get more of an idea of what Max can do, visit the website www.cycling74.com and click on the ‘projects made with Max’

View original post 24,603 more words

Advertisement

Watery fates….

Image

Going out to go underwater sound recording for Bangor New Music Festival 🙂

As I have been traveling everywhere by bus this week, which given the nature of what I do is not always that simple given the amount/delicate nature of kit that goes about the stuff in the box has become stripped down to the level of an art in itself…..

2 x hydrophones (lent by Bangor Uni School of Ocean Sciences)
1 x Fostex audio recorder
1 x remote control in case of wet situations
1 x headphones
1 roll of insulation tape for insulation, table tidying, and waterproofing.
1 roll of surgical tape for attaching things to people if required
1 roll of gaffa tape for almost anything
1 roll of aluminum tape for conductive and heat proof repairs
Wire cutters/strippers
1 x multimeter to mend stuff when it breaks
Scissors
25 x nappy bags for inexpensive waterproofing.
1 spoon for banging things to make noise
1 feather to ‘silently’ make tings make noise
Fishing line for suspending things
Balloons for suspending things in the water column.

Absolutely nothing that requires mains power!

‘Tis going to be great and mad, especially when there are 26 primary school kids all armed with microphones thrown into the mix too!

Moving on up!

photoAfter roughly 5 years, I am relocating my studio out of Hendre Hall to closer to home. There have been some great times there and I’d like to say thanks to all who have supported, listened and heckled over the years. Especial thanks must go to Malcolm and James Innes along with Mike ‘The Lights’ for putting up with the strange noises and random happenings. A massive thanks to everyone 🙂199738_10150174549315631_687534_nthumbs_edwright292833_10150363418310631_8193653_n182094_10150147756365631_2827187_n

I have had loads of fun there and created some cool things, even if I do say so myself! From: instrumental music, motion tracking party installations, through to surround sound acousmatic pieces, electronics and programing, and sonic marble runs I have had a blast.

All these have made in some way in that studio.

‘Starlight Snowfall’, String Ensemble and 4 channel electronics


‘Thinking Inside the Box’, Stereo fixed media installation
‘Crosswire’, for electric violin and live processing


‘Anatomy of a Mountain Stream’, 4 channel fixed media
‘Sound Games’, electronics and live controllers
‘Wordless Prayer’ Sound Sculpture (collaboration Hodges, Attard, Flescher)
‘Folksong’ Sound-sculpture
‘Live Study’ Live visual art sampling and electroacoustic
‘Jackdaws’ 4 Channel electroacoustic audio. For installation. Images by Helen Booth, performance poetry by Rhys Trimble.
‘This it Tomorrow’ 4 Channel electroacoustic audio. For installation. Sculpture by Dominic McGill

thisistomorrw
‘Amser/Time’ Electracoustic soundtrack. For stop-motion animation. Animation by Wendy Dawson and Tim Pugh.


‘Who can hear the Sea’, Octophonic evolving installation
‘DROP!’, Sound game installation

Thanks everyone, here’s to the next 5 years

800px-Smiley.svg

Bring it on!

BNMF

I’m honoured to say that I’m going to be the viola player for this ensemble and call for works so, please write something for us!

BNMF – Call for Scores
‘If music be the food of love, play on’
Piece inspired by Shakespeare
All students are invited to submit original scores for the Bangor New Music Festival, to be
performed on Friday 14 March 2014 by the Bangor New Music Ensemble. The location for
the performance will be outdoors, on Bangor High Street, with the use of the Deniol Shopping
Centre balcony. The piece could either use text by Shakespeare or be inspired by a dramatic
work by the playwright. The text could be in Welsh for the Tenor. A few instruments/voices
(with the exception of cello) may be positioned on the balcony, see the given plan below. (In
case of extreme weather conditions the performance will be relocated under the Shopping
Centre glass porch.)
Composers are invited to submit works for any combination of the following
instrumentation:
• Tenor (range: middle C – top Bb)
• Flute (doubling Piccolo and/or Alto)
• Clarinet (doubling Bass Clarinet)
• Violin (x2)
• Viola
• Cello (doubling Soprano, range: middle C – top A. Please do not include a part
where both cello and voice are performing simultaneously).
Deadline for submission is 12 noon, Friday 3 January 2014.
For more information, please contact Elina Hamilton at elina.hamilton@bangor.ac.uk or
01248 382183

This evening

I had a great night this eve, performing as part if Electroacoustic Wales. Fantastic to see so many people there and amazing to hear the piece that the kids from Ysgol Talwrn (for whom I have been running workshops) premiere to such a good reception.

It was also wonderful to get some work of mine out into the light of day again and I’m massively grateful to all the people who helped set up and pack down.

Most of all I enjoyed hearing Roy Wood’s most recent and last piece. Rest in Peace, but based on your 4’33” of noise (to quote your esteemed PhD supervisor) I don’t think you’d be up for that. Cheers mate I raise my post gig wine glass to you. Nos da!

Magnificat and Nunc Dimits on Bateriophage phiX174

Today I’ve been working on Magnificat and Nunc Dimits based around the base sequence of the chromosome of bateriophage phiX174 (the first complete mapped genome). On first inspection the code appears rather unpromising.

gagttttatc gcttccatga cgcagaagtt aacactttcg gatatttctg atgagtcgaa…

However the appearance is quite striking.

PhiX174

I’ve re-mapped the sequence to span an octave and imply rhythmic duration, and, oddly with a little bit of tweaking the system it comes out with some unexpectedly beautiful results. The table can be read like any ordinary table. Along the top is the genome ‘letter’ and down the side is how many times it comes in succession eg. aaaaaa would relate to A x 6.

A C G T
1 D A# G D#
2 C B E F
3 A# C C# G
4 G# D A G#
5 F# F A
6 E B
7 C#

According to the table this would result in the note E being sounded. Duration is also mapped by the number of repetitions although a lot more simply, the above Ax6 example would mean that note would last six quavers Tx3 for the quavers and so on. This gives us the original opening of the string:

gagttttatcgcttccatgacgcagaagttaa…

The string is the re-transcribed to show individual ‘events’:

g a g tttt a t c g c tt cc a t g a c g c a g aa g tt aa…

the letter and repetition data is then mapped and transformed as per the grid above giving:

G1 D1 G1 G#4 D1 D#1 A#1 G1 A#1 F2 B2 D1 D#1 G1 D1 A#1 G1 A#1 D1 G1 C2 G1 F2 C2…

This can be then translated into standard notation by simply taking the letter and # to indicate pitch and the number to signify the duration in units of a quaver.

Screen Shot 2013-06-25 at 12.23.01

The notation shows the resulting opening bars. The resulting monophonic line will form the basis of the organ part, tempo dynamics, rests and bar lengths can then be composed around this as the choral lines and text are worked into this sub-structure.

Currently this has been realised relatively simply. I have pasted the genome data into Word and converted it with a find and replace function to give the G1 D1 G1 G#4 D1 D#1 A#1 G1 A#1 F2 B2 D1 D#1 G1 D1 A#1 G1 A#1 D1 G1 C2 G1 F2 C2… string. I then put together a quick program/patch in Max MSP to convert the raw text of the word file into MIDI data and hence to audible pitches.

Screen Shot 2013-06-25 at 12.33.12

To give…

This audio is just the first few minutes of it, hopefully soon I’ll also work out ways of working in other dimensions to extract chords, dynamics and orchestrations out of it too. I have also been rolling out Markov chain stuff to provide a form of mutation to further work the data, but more of that anon.

Philosophically and ideologically I’m quite excited by the idea of combining the word setting and the DNA form. There feels as if there is something a bit subversive and yet also praising about the idea, a tug of war between evolutionary chemistry and the work of divine precision and creation. I can’t quite put my finger on it but working the piece out feels like it may be one amazing ride!

On ‘playing’ flaming pianos

Piano Burning Annea Lockwood

Sat 29th June 6:45 The Old Goods Yard Bangor.


Bangor Sound City and Soundlands in partnership with the Harwich Festival of the Arts and The Old Goods Yard Artists’ Collective present a performance of 3 of Lockwood’s 1960’s-70’s Piano Transplant series. Annea will be performing alongside guests Xenia Pestova, Sarah Westwood and Ed Wright, along with live video link ups to the other two works:

Piano Burning – The Old Goods Yard Bangor

Piano Garden – Gwydyr Forest

Eastern Exposure – Harwich Beach

The will also be responses to the work from members of The Old Goods Yard Artists’ Collective including: Martin Daws, ScrapYardQueen, Urban Dance Collective, Tim Cumine, Henry Horrell and Brian Nylon.

20130620-114149.jpg

If you need the loo, please go before listening to this piece!

Anatomy of a Mountain Stream: quadraphonic fixed media, binaural version.

Field recording & processing programming: Edward Wright

Binaural-ID

We often take things for granted until we look carefully at them. During the cold snap of the winter of 2011 when the snow had dampened all the sounds I bravely/foolishly balanced a surround sound recorder on a rock in the middle of the stream that runs down from the Carneddau, through Parc Plas Mawr in Penmaenan on its way to the sea.

Through manipulating the playback speed of the resulting sound-file it was possible to expose many details of the sound that are often obscured by our ‘normal’ way of listening. By simply changing the sampling rate, we can enter what feel like different sonic dimensions where the very large, and minutely small sonic structures become far more apparent.

flickbookEffectively this means that I have slowed down and sped up the audio. More precisely a computer or CD player reads through audio in a number of steps much like you would go through pages in a flick book but a lot faster (CD reads at 44100 ‘steps’ per second).

All that I have changed is how quickly those steps are taken. What this does is to not only change the pitch of the audio as the sound waves become compressed or stretched out, but also to chance the perception of events. Things that seem a blur become a series of discrete happenings and events that seemed slow and random start to show striking regularity when viewed over a longer (or more compressed) time frame.

In this piece the original 8 minute sound-file is played in its entirety, but the speed has been mapped and composed to create the framework of the piece. The audio was recorded on a Zoom H2 at 4chan x 48kHz x 24 bit, processed in Max/MSP 5.

Screen Shot 2013-04-18 at 17.27.51This version of the work had been mixed to give an approximation of the quadraphonic set-up of the speakers (i.e. 2 in-front and 2 behind) on headphones.

This has been achieved by playing a sound impulse from each speaker and measuring how it gets to a listeners ears. A sound from the extreme left will take slightly longer to reach the right ear than it takes to get to the closer left ear. Also the journey that the sound waves have to take around the head will absorb some of the energy, although not evenly across all pitches, changing fractionally changing the tone of the sound by the time it reaches the further ear.

 hrtf

Image from http://www.cns.nyu.edu/~david/courses/perception/lecturenotes/localization

4mic in streamcopyrightIf you played a sound from the right front speaker (for instance) and recorded that sound from microphones placed in the ears of a listener you can compare the signal from the speaker with those that have arrived at the ears. From this point we can work out what the change is and can also apply that change to any other sound.

This has been scaled up to the 4 separate audio channels and processed (impulse convolved) with the spatial data collected from the in ear microphones hence why you need to listen on headphones to get the full effect

SO, PLEASE ONLY LISTEN ON HEADPHONES NOT ON LOUDSPEAKERS!

In Defence of Dandelions

For many people the humble dandelion is one of the scourges of the garden; a sign of the arrival of summer as welcome as its counterpart, the wasp.

As children many of us have taken great delight in blowing dandelion clocks, even though they will never win any prizes as accurate time pieces, and through teenage and adolescent years giggled about their apparent capacity to make you wet the bed. As adults though this relationship seems to change as people become concerned with pristine lawns, uniform blandness and an aesthetic of beauty which seems far more concerned with uniformity and control than any sense of diversity, ecology or indeed, fun.

So, dandelions are fun! You can blow them you can flick them, you can make massive ‘daisy’ chains out of them, you can draw with them, make a form of coffee and indeed wine.

ImageImage

Being blessed with a five year old daughter and a partner who loves gardening and all things rustic/organic getting hold of lots of dandelions does not represent too much of an issue, on a sunny day they can happily collect them by the bucket load.

As a student I first noticed the massive haul of these bright yellow followers around the common on which my parents live. I was also lucky enough to have a neighbour, closer in-fact to an adopted Granny, who handed down to me the recipe for making wine out of this abundant and free resource. Now don’t get me wrong, your first attempt at making this is unlikely to win awards, but is is a fun, and very inexpensive way of making a nice drink for the hot late summer evenings, or more likely have something to drink on a rainy night in August. I don’t know how unique or not this recipe is, but it’s nice!

Ingredients:

8 pints of dandelion flowers

8 pints of water

3 ib of sugar

1 inch whole ginger

1 lemon

1 orange rind

1 tbsp of brewers yeast (bread yeast works too)

1 slice of toast

1 handful of raisins (optional)

Method:

  • Boil the flowers in the water (to kill all the cat wee).
  • Cover it and leave it for 3 days to infuse.
  • Strain it into a large pan through some muslin sheeting.
  • Add the sugar, ginger, chopped lemon and the orange rind and heat gently for ½ hour.
  • Activate the yeast on the slice of toast
  • When everything has cooled down add the yeast and toast to the pan.
  • Pour the whole lot into glass demijohns (you may need to chop stuff up a bit to fit it through the neck) add the raisins if you want to.
  • Ferment with air locks for about 60 days.
  • Have a glass and enjoy 🙂